ID: 994717241

View in Genome Browser
Species Human (GRCh38)
Location 5:103336286-103336308
Sequence CAGAATACACAACCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994717241_994717243 6 Left 994717241 5:103336286-103336308 CCTTGGGCAGGTTGTGTATTCTG No data
Right 994717243 5:103336315-103336337 GAAGGCTGAATGTTCCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994717241 Original CRISPR CAGAATACACAACCTGCCCA AGG (reversed) Intergenic
No off target data available for this crispr