ID: 994719807

View in Genome Browser
Species Human (GRCh38)
Location 5:103367351-103367373
Sequence CCCCATGCACAGTGTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994719802_994719807 2 Left 994719802 5:103367326-103367348 CCCAAGAGCTGAGCTGAGCCATG No data
Right 994719807 5:103367351-103367373 CCCCATGCACAGTGTCAGCAGGG No data
994719801_994719807 7 Left 994719801 5:103367321-103367343 CCATACCCAAGAGCTGAGCTGAG No data
Right 994719807 5:103367351-103367373 CCCCATGCACAGTGTCAGCAGGG No data
994719803_994719807 1 Left 994719803 5:103367327-103367349 CCAAGAGCTGAGCTGAGCCATGT No data
Right 994719807 5:103367351-103367373 CCCCATGCACAGTGTCAGCAGGG No data
994719800_994719807 17 Left 994719800 5:103367311-103367333 CCAAGTCGAGCCATACCCAAGAG No data
Right 994719807 5:103367351-103367373 CCCCATGCACAGTGTCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994719807 Original CRISPR CCCCATGCACAGTGTCAGCA GGG Intergenic
No off target data available for this crispr