ID: 994721819

View in Genome Browser
Species Human (GRCh38)
Location 5:103389446-103389468
Sequence TGTGAAATGACACCAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994721819_994721823 23 Left 994721819 5:103389446-103389468 CCAGATTCTGGTGTCATTTCACA No data
Right 994721823 5:103389492-103389514 GTAGGCTGCTGCCGGCCCTAAGG No data
994721819_994721820 1 Left 994721819 5:103389446-103389468 CCAGATTCTGGTGTCATTTCACA No data
Right 994721820 5:103389470-103389492 ATTATATTTGTACTATTGCTAGG No data
994721819_994721821 5 Left 994721819 5:103389446-103389468 CCAGATTCTGGTGTCATTTCACA No data
Right 994721821 5:103389474-103389496 TATTTGTACTATTGCTAGGTAGG No data
994721819_994721822 15 Left 994721819 5:103389446-103389468 CCAGATTCTGGTGTCATTTCACA No data
Right 994721822 5:103389484-103389506 ATTGCTAGGTAGGCTGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994721819 Original CRISPR TGTGAAATGACACCAGAATC TGG (reversed) Intergenic
No off target data available for this crispr