ID: 994722089

View in Genome Browser
Species Human (GRCh38)
Location 5:103392135-103392157
Sequence CTGATTTATCCTGAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994722081_994722089 26 Left 994722081 5:103392086-103392108 CCTCTGTAAGGAATGTAAGATGG No data
Right 994722089 5:103392135-103392157 CTGATTTATCCTGAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994722089 Original CRISPR CTGATTTATCCTGAGGTGGT GGG Intergenic
No off target data available for this crispr