ID: 994727597

View in Genome Browser
Species Human (GRCh38)
Location 5:103454586-103454608
Sequence GGTCACTCCTTTCAAAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994727597_994727602 4 Left 994727597 5:103454586-103454608 CCCTCATTTTGAAAGGAGTGACC No data
Right 994727602 5:103454613-103454635 TTTCCTGAGAGGAAGTGTTCTGG No data
994727597_994727600 -7 Left 994727597 5:103454586-103454608 CCCTCATTTTGAAAGGAGTGACC No data
Right 994727600 5:103454602-103454624 AGTGACCTGGTTTTCCTGAGAGG No data
994727597_994727604 14 Left 994727597 5:103454586-103454608 CCCTCATTTTGAAAGGAGTGACC No data
Right 994727604 5:103454623-103454645 GGAAGTGTTCTGGTTCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994727597 Original CRISPR GGTCACTCCTTTCAAAATGA GGG (reversed) Intergenic
No off target data available for this crispr