ID: 994733243

View in Genome Browser
Species Human (GRCh38)
Location 5:103519753-103519775
Sequence AGGGAGAAGCAATTGACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994733243_994733252 22 Left 994733243 5:103519753-103519775 CCACTGGTCAATTGCTTCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 242
Right 994733252 5:103519798-103519820 ACCTCTTGGAACCAATTCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 119
994733243_994733251 21 Left 994733243 5:103519753-103519775 CCACTGGTCAATTGCTTCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 242
Right 994733251 5:103519797-103519819 CACCTCTTGGAACCAATTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 116
994733243_994733249 8 Left 994733243 5:103519753-103519775 CCACTGGTCAATTGCTTCTCCCT 0: 1
1: 0
2: 1
3: 18
4: 242
Right 994733249 5:103519784-103519806 TCACTAGCTCTTCCACCTCTTGG 0: 1
1: 0
2: 0
3: 37
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994733243 Original CRISPR AGGGAGAAGCAATTGACCAG TGG (reversed) Intergenic
900746030 1:4361346-4361368 AGGCAGAAGCCATGGCCCAGGGG - Intergenic
904749150 1:32730154-32730176 AGGGACAATCCTTTGACCAGGGG + Intergenic
905485445 1:38292682-38292704 AGGGGGATGCTATTGACCACAGG - Intergenic
908722331 1:67138889-67138911 AGGGAGAAGCAGGTGACTAATGG + Intronic
909913792 1:81292888-81292910 AGGGAAAAGCAATTCAAAAGAGG + Intergenic
912020454 1:105102716-105102738 AGGGAGAAGGAACAGAACAGAGG - Intergenic
912176557 1:107165103-107165125 AGGATGGAGCAAGTGACCAGGGG + Intronic
913018286 1:114761862-114761884 AGGAAGAACCAGTTAACCAGGGG - Intergenic
913707824 1:121445144-121445166 AGGGAGAAGCTATTCATCTGGGG - Intergenic
914216072 1:145629753-145629775 ATGGAGAAGCAGAAGACCAGAGG + Intronic
914468641 1:147952406-147952428 ATGGAGAAGCAGAAGACCAGAGG + Intronic
916561919 1:165940886-165940908 AGGGAGCAGCCACTGCCCAGGGG + Intergenic
917599774 1:176562491-176562513 AGGAAGAAGCAACTGAGGAGAGG - Intronic
919198344 1:194317757-194317779 AGGAAAAAGCAGTTGCCCAGAGG + Intergenic
919669669 1:200327428-200327450 AGGGAGAAGTAATTGTGCTGGGG - Intergenic
919895075 1:202004604-202004626 AGGGAGGGGCAAATGACCTGAGG + Intronic
920292124 1:204930614-204930636 AGGCAGGAGGAAATGACCAGTGG + Intronic
921203214 1:212826317-212826339 AGGATGAAGCAGGTGACCAGGGG + Intergenic
921295115 1:213693964-213693986 AGGCAGAAGCCATTGAACCGAGG - Intergenic
923205961 1:231759169-231759191 ATTGAGGAGCAATTGGCCAGAGG - Intronic
923320266 1:232825214-232825236 AGGGAGAAGCACTTGAACTCAGG + Intergenic
1063167721 10:3479056-3479078 ACGGAGAAGCAGCCGACCAGCGG - Intergenic
1064633389 10:17340257-17340279 AGGACGAAGCAGGTGACCAGGGG - Intronic
1065331409 10:24604024-24604046 AGGGAGAAGAAAGAGAACAGGGG + Intronic
1067041633 10:42956189-42956211 AAGGAGAAGCTATTGGCAAGAGG - Intergenic
1067092788 10:43278178-43278200 TGGGAGAATCACTTGAACAGGGG - Intergenic
1068321720 10:55426824-55426846 TCGGAGAAGAAATTGGCCAGAGG - Intronic
1069362999 10:67665204-67665226 AGGCAGATTCAATTGAGCAGAGG - Intronic
1069433363 10:68357073-68357095 AGGGAGAATCACTTGAACCGGGG + Intronic
1069448870 10:68499937-68499959 AGGAAGAAACAATTGAGAAGAGG + Intronic
1069644644 10:69984838-69984860 TGGGAGAAGCACTTGAGCACAGG + Intergenic
1070550895 10:77489850-77489872 AGTTTGAATCAATTGACCAGAGG - Intronic
1071464013 10:85923241-85923263 AGGGAAAAGCAGTTGAACATGGG + Intronic
1073999662 10:109357543-109357565 AGGGAGAATCAATTGAGCCTAGG + Intergenic
1077559740 11:3252166-3252188 AGGATGAAGCAGGTGACCAGGGG - Intergenic
1077565634 11:3297969-3297991 AGGATGAAGCAGGTGACCAGGGG - Intergenic
1078550240 11:12275267-12275289 ACGGAGATGCAAGTGAGCAGTGG + Intergenic
1078880709 11:15446247-15446269 AGGGAGAAACAGTTGACCAGAGG + Intergenic
1079283253 11:19106775-19106797 AGGGAGAGGCACTTCCCCAGTGG + Intergenic
1080562146 11:33473781-33473803 AGGGAGTAGGATTTGACCAGTGG - Intergenic
1080680593 11:34472332-34472354 AGGAAGAGGAAAGTGACCAGTGG - Intergenic
1082007222 11:47426140-47426162 AGGGAGACGCCATTGACAAGAGG - Intronic
1083596024 11:63918562-63918584 AAGGAGAATGAATGGACCAGGGG + Intergenic
1087201094 11:95345427-95345449 AGGGAGAAGCAGCTGACAGGAGG + Intergenic
1089137415 11:116260833-116260855 ACAGAGAAGCCATTGACCAGGGG + Intergenic
1089186116 11:116615747-116615769 AGGGGGAAGCAGTTGACAATGGG + Intergenic
1091937832 12:4447345-4447367 AGGTAGAAGCCACAGACCAGAGG - Intergenic
1092273789 12:7043935-7043957 AGAGAGAAGTAATCGAGCAGAGG - Intronic
1092953080 12:13525968-13525990 AGGGAGATGGAATTCAGCAGTGG + Intergenic
1093954566 12:25201509-25201531 AAGGAGAAGCAATTGGAGAGGGG + Intronic
1095044264 12:37482905-37482927 AGGGAGAATCACTTGAACACAGG + Intergenic
1096026484 12:48368652-48368674 AAGGAGAAGGAAGTGACCACTGG + Intergenic
1097301933 12:58028261-58028283 ATGGAGAAGCCATTAACCACTGG - Intergenic
1097919183 12:65053194-65053216 TGTGAGAAGCAATTTTCCAGAGG + Intronic
1099614191 12:84913332-84913354 ACGGAGAAGCCAATGCCCAGAGG - Intronic
1100077523 12:90803450-90803472 AGGGAGAAAGAAATGACCATTGG - Intergenic
1101853975 12:108426897-108426919 AGGGAGTAGCAACTGAGCATTGG + Intergenic
1101876544 12:108599887-108599909 AGGGAGAAGCAAAGAACGAGGGG - Intergenic
1104224645 12:126819721-126819743 AGGATGGAGCAAGTGACCAGGGG - Intergenic
1104558181 12:129821007-129821029 AGGGAGAAGAAAATGAAGAGAGG - Intronic
1105780805 13:23703878-23703900 AGGGAGAAGCGGATGCCCAGAGG + Intergenic
1106466630 13:30019682-30019704 AGGTAGAAGCAAGGGAGCAGAGG + Intergenic
1106982809 13:35309640-35309662 AGGAAAGAGCAATTGCCCAGTGG - Intronic
1107279580 13:38718439-38718461 AGGGAGAAGGAATTGTAAAGGGG - Intronic
1107328893 13:39275354-39275376 AGGGAGAAGCAATGACCTAGTGG + Intergenic
1107601290 13:42015497-42015519 AGGAGGAAGCAAATGTCCAGTGG + Intergenic
1109900226 13:68759013-68759035 AGTGAGAAGGACTTGACCTGTGG - Intergenic
1109950736 13:69499816-69499838 AGGGAGAATCACTTGAACATGGG + Intergenic
1110937305 13:81307186-81307208 AGGGAGAGGCAATTTCCCAAGGG + Intergenic
1112345014 13:98581909-98581931 TGGGAGGTGCAATTTACCAGGGG + Intergenic
1112438488 13:99408356-99408378 TGGGAGAACCCAGTGACCAGCGG - Intergenic
1112467925 13:99660282-99660304 TGGGAAAGGCAATTGAACAGTGG + Intronic
1113603625 13:111588983-111589005 AGGGTGAAGCAAAAGGCCAGTGG + Intronic
1113743176 13:112724993-112725015 AGGGAGAAGAAAATGACGTGGGG - Intronic
1114351103 14:21852315-21852337 AGGAAGAAGAAACTGAGCAGTGG - Intergenic
1114355416 14:21902835-21902857 AGGAAGAAGAAACTGAGCAGTGG - Intergenic
1115981267 14:39054180-39054202 TGGGAGAATCACTTGAGCAGGGG + Intronic
1117690256 14:58298846-58298868 AGGGGCCAGCCATTGACCAGCGG + Intronic
1118692306 14:68351911-68351933 AGGCAGATGCAATTGTCCATGGG + Intronic
1119283253 14:73429064-73429086 AGGGAAAGAAAATTGACCAGTGG - Intronic
1119583097 14:75805403-75805425 AGGGAGAAGCAGATGCCCAGGGG - Intronic
1120153889 14:81069571-81069593 AGGGCTAAGAAACTGACCAGAGG + Intronic
1120827893 14:88971599-88971621 GGGGAGAAGCAGTTCTCCAGTGG + Intergenic
1121631033 14:95422135-95422157 AGGGAGAAGCTGATGGCCAGAGG - Intronic
1121786007 14:96661545-96661567 AGGAAGAAGCAGTTGTCCACTGG - Intergenic
1202942812 14_KI270725v1_random:170568-170590 AGGGAGAATCACTTGAACATAGG + Intergenic
1126290651 15:47073194-47073216 AGGGAGAATCACTTGAACACAGG - Intergenic
1128200906 15:65807156-65807178 AGGGAGAATCAATTGAACCCGGG - Intronic
1128839860 15:70841364-70841386 AGGGAGAAGGAGTTGCCCAACGG - Intronic
1129675211 15:77629651-77629673 AGGGAGTAGCTATTGGCTAGCGG - Intronic
1130140641 15:81223315-81223337 AAGGAAAAGCAAGTGACAAGAGG + Intronic
1131489093 15:92846769-92846791 AAGGACAAGCAATAGACCAGGGG - Intergenic
1133307956 16:4822973-4822995 AGGGAGAAGGAAGTGACCTTTGG - Intronic
1133886381 16:9831853-9831875 AGAGATAGGCAATTGACCATGGG - Intronic
1133915986 16:10110461-10110483 ATGGAGAAGCAAGTGGCAAGGGG + Intronic
1134338189 16:13320613-13320635 TGGAAGAAGCCATTGTCCAGAGG - Intergenic
1135510109 16:23075216-23075238 AGGAAACAGCAATTGGCCAGTGG + Intronic
1137627032 16:49915640-49915662 AGGGAGAAGCCAGTGTCCAAAGG + Intergenic
1137980018 16:53061579-53061601 ATGGAGACCCAATTGCCCAGTGG - Intronic
1138433592 16:56984761-56984783 AGGATGGAGCAAGTGACCAGGGG - Intergenic
1138785775 16:59844726-59844748 AGGTAGAAGCAAGGGCCCAGGGG - Intergenic
1139314099 16:66053279-66053301 AGTGAGAAGGAATTGATCAGGGG + Intergenic
1139344807 16:66296129-66296151 AGGAAGCAGAAATTCACCAGAGG - Intergenic
1140276816 16:73516664-73516686 AGGAAGAAGAAATTGATTAGAGG - Intergenic
1141274205 16:82570332-82570354 AAGGAAACGCCATTGACCAGAGG - Intergenic
1142803921 17:2361843-2361865 AGGAAGTAGCAATTGCCAAGTGG - Intronic
1145053645 17:19683465-19683487 TGGGAGAAGCCATCGACCAGTGG + Intronic
1148231846 17:45941028-45941050 AGGAAAAAGCAATTGACTCGAGG - Intronic
1149486250 17:57045447-57045469 AGGGAGCAGCAAATGGCCGGCGG + Intergenic
1150282683 17:63938538-63938560 AGGGAGAAGCCACATACCAGAGG + Exonic
1152037453 17:77881866-77881888 AGGGGGCAGCAAGTGAGCAGGGG + Intergenic
1153069554 18:1089607-1089629 AGGGAGAAGGAATTCTCTAGCGG - Intergenic
1155397582 18:25403065-25403087 TGGGAGAGGCACTTGAGCAGGGG - Intergenic
1157060236 18:44279583-44279605 AAGGAAGAGCAATTGAACAGGGG + Intergenic
1159443818 18:68514599-68514621 GGGTAGAAGCAATTGATCCGGGG + Intergenic
1160016001 18:75141232-75141254 AGGAAGGAGCCATGGACCAGGGG + Intergenic
1160558976 18:79744708-79744730 AGTGAGAACCAACTCACCAGTGG + Intronic
1160939413 19:1613404-1613426 AGGGAGAAGCAGTTACCCTGTGG - Intronic
1161258259 19:3321645-3321667 AGGGAGAAGCCACTGGCTAGGGG + Intergenic
1167766389 19:51485507-51485529 AGGGAGAAGAGATTGGGCAGTGG + Intronic
926299049 2:11589233-11589255 AGAGAGAAGCAATAAACCAGTGG + Intronic
928336319 2:30401413-30401435 ATGGAGAAGCAATTTCCCCGAGG - Intergenic
928351293 2:30557922-30557944 ATGGATATTCAATTGACCAGTGG - Intronic
928357465 2:30632444-30632466 AGGGAGAAGCAACTGTTTAGAGG - Intronic
928404590 2:31004868-31004890 AGGGAAAAGCAATTTTCAAGAGG + Intronic
929552809 2:42905164-42905186 AGGGAGGAGTAATTGACCCAGGG + Intergenic
931093886 2:58917998-58918020 CGGAAGAAGGAATTGACCTGAGG + Intergenic
932474504 2:71993520-71993542 AGAGAGAAGGAATTGGTCAGAGG + Intergenic
934745119 2:96754373-96754395 AGTGGGAAGCACTTGGCCAGTGG - Intergenic
935759620 2:106309016-106309038 AAGGAGAAACAAATGATCAGAGG - Intergenic
936551182 2:113441491-113441513 ATGGAATAGCAATTCACCAGAGG - Intronic
939136725 2:138305038-138305060 AGGGAGAAGGAAAAGATCAGAGG - Intergenic
939846375 2:147251358-147251380 AGGGAGAAGCAAATGGGTAGAGG + Intergenic
940049484 2:149447365-149447387 AGGAAGAGGCAACTCACCAGTGG + Intronic
940669200 2:156646933-156646955 AGTGGAAAGCAATTGACCAGTGG + Intergenic
942553550 2:177147291-177147313 AACGAGAAGCAGTTGAACAGTGG + Intergenic
943034966 2:182731961-182731983 AGGGAGAAGCAATTTACTTGAGG - Intronic
943366292 2:186970440-186970462 AGGGAGAAGCCATGGACCTGAGG - Intergenic
946039055 2:216768475-216768497 AAGAAGAAGAAATTGACTAGTGG + Intergenic
947001668 2:225464277-225464299 AGGAAGAGGCAATTGAGCAGAGG - Intronic
947455366 2:230249198-230249220 AGGGAGAACGAATATACCAGAGG + Intronic
948073684 2:235148483-235148505 AGTGAGAAGCACCTGACCTGTGG - Intergenic
948075269 2:235161047-235161069 AGAGAAAAGGAATGGACCAGAGG - Intergenic
1168852442 20:985842-985864 GGGGAGAAGCTATGAACCAGAGG + Intronic
1169891825 20:10461729-10461751 AGGGAAAGGCAATTGGCCACTGG - Intronic
1170471159 20:16669608-16669630 AGTGAGAGGAAACTGACCAGAGG - Intergenic
1171802232 20:29633750-29633772 AGGGAGAATCACTTGAACACAGG - Intergenic
1171841741 20:30221841-30221863 AGGGAGAATCACTTGAACACAGG + Intergenic
1172019903 20:31906739-31906761 TGGGAGAATCACTTGAGCAGGGG - Intronic
1175395648 20:58658809-58658831 AGGGAGAAGCATGACACCAGAGG - Intronic
1176219096 20:63961592-63961614 AGGGAGAGGCAGGTGCCCAGGGG + Intronic
1181984876 22:26793188-26793210 TGGGAGAAGCATCTGTCCAGGGG - Intergenic
1182241672 22:28920989-28921011 AAGGAGAAGCATGTGGCCAGTGG - Intronic
1182367232 22:29787474-29787496 AGGGACAAGCACTGGACCTGAGG + Intergenic
1182452453 22:30429498-30429520 CTGGAGAAGGAAGTGACCAGGGG + Intergenic
1183557665 22:38543745-38543767 AGGACAGAGCAATTGACCAGGGG - Intronic
1183954757 22:41372800-41372822 AGGGAGAGGCATTTGAACTGAGG + Intronic
1185306311 22:50119164-50119186 ACGGGGAAGTAACTGACCAGGGG - Intronic
950017954 3:9767582-9767604 AGGAAGCATTAATTGACCAGAGG + Intronic
951664136 3:25103189-25103211 TGGGAGAAGCATTTTACCATTGG + Intergenic
952180477 3:30911483-30911505 AGAGAGAAAGAAGTGACCAGAGG - Intergenic
952860701 3:37810143-37810165 AGGCAGCAGCAAATGACCATAGG - Intronic
959087617 3:101868201-101868223 AGGGAGAATCACTTGACCCCGGG - Intergenic
960001614 3:112737526-112737548 AGGGAAAAGCAATAGAACAGAGG + Intergenic
962654141 3:137525474-137525496 AAGGAGAAGAAATTTATCAGTGG + Intergenic
963664392 3:148164330-148164352 ATGAATAAGCAATTGACTAGTGG - Intergenic
964472234 3:157067929-157067951 AGGGAGAAATATTTGGCCAGAGG + Intergenic
964862313 3:161216500-161216522 AGGGAGAGGCAATTTCCCAATGG + Intronic
968010057 3:195268729-195268751 AGGCAGCTGCAAATGACCAGAGG - Intronic
968734423 4:2288067-2288089 AGGCAGAAGCAACTGGCCTGTGG + Intronic
970202404 4:13623298-13623320 TGGGTGAATAAATTGACCAGGGG + Intronic
973808075 4:54544704-54544726 AGGGAGAATCTGTTGACCAAGGG - Intergenic
974243804 4:59287305-59287327 TTGGAGAAGCTATTCACCAGTGG - Intergenic
975826049 4:78320463-78320485 ATGGAGAAGCAATTAAACAGAGG - Intronic
978883786 4:113741940-113741962 AGGAAGAAGCATTTGAGCTGAGG - Intronic
984586620 4:181571427-181571449 AGGGAGAATCATTTGAGCACAGG - Intergenic
985664622 5:1175550-1175572 AGGGAGAAGGCAGAGACCAGAGG - Intergenic
987124479 5:14798773-14798795 AGGGAGAAGGGAAAGACCAGTGG - Intronic
990604474 5:57395114-57395136 GGGGAGAAGAAACTAACCAGAGG + Intergenic
993884322 5:93398261-93398283 AGGGAGACTCCATTGTCCAGAGG + Intergenic
994200933 5:96974868-96974890 AAGGAGAAGAAATGGACCAAAGG - Intronic
994654928 5:102580720-102580742 AGAGAGAAGCAATTAACAAAAGG + Intergenic
994733243 5:103519753-103519775 AGGGAGAAGCAATTGACCAGTGG - Intergenic
998006971 5:138663441-138663463 AGAGAGAAGCATTTATCCAGTGG - Intronic
999637645 5:153639448-153639470 AGGCAGAAGGAATGGAACAGAGG - Intronic
999914093 5:156238426-156238448 AGGCAAAAGCAGTTGCCCAGAGG - Intronic
1000280775 5:159780107-159780129 AGGCAGGAGCACCTGACCAGAGG - Intergenic
1001747624 5:174103870-174103892 AGGGAGAAGCACTTGAACCTGGG + Intronic
1001867915 5:175121431-175121453 AGGGAGATGCCAGTGACCAAAGG + Intergenic
1002199889 5:177521740-177521762 AGGGAGGAGTAATAGAACAGAGG + Intronic
1002858466 6:1058588-1058610 AGGGTGAACCTGTTGACCAGGGG + Intergenic
1003998345 6:11567002-11567024 AGGGAGAGGCAATTTCCCAATGG - Intronic
1004761173 6:18668168-18668190 AGGGAGAGGGAATTGAGAAGGGG - Intergenic
1005344739 6:24878001-24878023 AGGATGAAGCAGGTGACCAGGGG + Intronic
1005382649 6:25252615-25252637 AGGGAAAAGCAATTGGTCAAGGG - Intergenic
1008201609 6:48597964-48597986 GGGTAGAAGAAATTGCCCAGAGG - Intergenic
1008669314 6:53750718-53750740 AGGGGGAAGCAATAGACAAGTGG + Intergenic
1008703247 6:54127053-54127075 AGAAGGAAGCATTTGACCAGAGG - Intronic
1009566864 6:65320969-65320991 AGGGGAAAACAATTGAGCAGAGG - Intronic
1009947108 6:70352795-70352817 GGTGAGAAGCAAATGACAAGTGG + Intergenic
1010543466 6:77121635-77121657 AGGGAGAAGTCAATGACAAGAGG + Intergenic
1013276327 6:108588559-108588581 AGGCAGAAGCAGTAGACCAGAGG - Intronic
1013546086 6:111158982-111159004 TGGGAGGGTCAATTGACCAGAGG + Intronic
1014212669 6:118722681-118722703 AGAGAGAAGCCATTGACCCTAGG - Intergenic
1014463881 6:121730842-121730864 AGGAAGGAGCAGGTGACCAGGGG + Intergenic
1015282677 6:131450607-131450629 AGAGAGATGCAATTGTCCACAGG - Intergenic
1015794390 6:136996664-136996686 AGGGACAGGCAAATGACCAATGG + Intergenic
1016040285 6:139425726-139425748 AGAGAGAAGCAGTTGACTATAGG - Intergenic
1017105075 6:150879720-150879742 AGGGAGAATCACTTGAACATGGG - Intronic
1018662838 6:166104381-166104403 AGGGAGATGTAAGTGACCACTGG - Intergenic
1018837866 6:167498650-167498672 AGGGAGAAGCCACAGCCCAGTGG + Intergenic
1019676922 7:2319247-2319269 TGGGAGAACCACTTGACCCGGGG + Intronic
1021956000 7:25825056-25825078 AGGGAGAAGCAAGTGCTCTGTGG + Intergenic
1022438404 7:30411905-30411927 AATGAGAAGCAATGGACTAGAGG + Intronic
1022644416 7:32217073-32217095 AGGGAGAAGCTACTGACAAAGGG + Intronic
1023105194 7:36756907-36756929 AGGGAGAAGCTATGAAGCAGAGG + Intergenic
1024964159 7:55006653-55006675 AGGGAGGAGGAAGTGACCTGGGG + Intergenic
1025290189 7:57712452-57712474 AGGGAGAATCACTTGAACACAGG + Intergenic
1030141367 7:106307447-106307469 TGGGAGAGGAAGTTGACCAGAGG + Intergenic
1030582618 7:111377479-111377501 AGGGAAAAGCAGTTTACCACAGG - Intronic
1030841159 7:114355955-114355977 AGGTAGAAGTAGTTGAACAGAGG - Intronic
1031969251 7:128052227-128052249 AGGCAGAAGAAATGGACCACTGG - Intronic
1032181543 7:129683419-129683441 AGGGAGAATCACTTGAACACAGG - Intronic
1032885515 7:136134047-136134069 AGGGAAAAGCCCTTGGCCAGGGG - Intergenic
1033663225 7:143417988-143418010 AGGCAGAAGCAAGTGGCCAAGGG + Intergenic
1036403832 8:8436080-8436102 AGGGAGAATCACTTGACCCTGGG - Intergenic
1036448752 8:8846372-8846394 AAGGAGAAGAAAATGACCACTGG + Intronic
1036986430 8:13536649-13536671 AGGAAGCAGCCTTTGACCAGGGG - Intergenic
1037903022 8:22698973-22698995 TGGGAGAAGCCATCGCCCAGAGG + Intergenic
1038750986 8:30295681-30295703 GGGGAGAAAGAATTGGCCAGAGG - Intergenic
1041122129 8:54597218-54597240 AGGGAGTAGTAATTAACCAAAGG - Intergenic
1041191366 8:55358789-55358811 AGGGAGCAGCATGTGCCCAGAGG - Intronic
1043100244 8:76035915-76035937 AGGGAGGAGCAATTGCACAGTGG + Intergenic
1045838205 8:106548324-106548346 TGGGAGGAGCACTGGACCAGGGG - Intronic
1046249995 8:111617416-111617438 AGGTAGGAGGAATTGAACAGCGG + Intergenic
1047827080 8:128588505-128588527 AGGAAAAAGCATTTGACCAATGG - Intergenic
1048924368 8:139258188-139258210 AGCAAGAAGCAAGTGAACAGAGG - Intergenic
1049919339 9:348574-348596 AGGCAGAAGCAATGGAGAAGTGG + Intronic
1049966256 9:782913-782935 AGGGAGCAGCAAGTGACAAATGG + Intergenic
1053481379 9:38418879-38418901 AGGGAGACTCAAATGCCCAGGGG + Intronic
1053514021 9:38714301-38714323 AGGCAGAATCCATTGATCAGTGG + Intergenic
1054166237 9:61732957-61732979 AGGGAGAATCACTTGAACACAGG - Intergenic
1055226827 9:74007133-74007155 AGGGAGCAGTAATTGACTATGGG - Intergenic
1056168114 9:83957893-83957915 AGGGAGAATCACTTGAACCGGGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1058392395 9:104510794-104510816 AGGGAGAAGGAAGTCAGCAGTGG - Intergenic
1058793941 9:108478728-108478750 AGGGAGAGTCAAGTAACCAGAGG + Intergenic
1058835107 9:108853735-108853757 AGGGAGAATCATTTGACCCCAGG - Intergenic
1059782404 9:117543702-117543724 AGGGCCAAGCACTTGAGCAGGGG - Intergenic
1060668464 9:125447745-125447767 AGGCAGAAGCACCTGGCCAGAGG + Intronic
1062675746 9:137742679-137742701 AGGGAGAAGCAAATGTCTGGGGG - Intronic
1186703847 X:12121519-12121541 AAGGTGAAGTAATGGACCAGTGG - Intergenic
1186896703 X:14011111-14011133 AGGGAGAAGCTAGTCCCCAGCGG - Intronic
1187188009 X:17006066-17006088 AGGAAGAGGAAATTGACCAGTGG + Intronic
1187199443 X:17120814-17120836 AAGGAGAATCAATTGGCAAGAGG + Intronic
1190741938 X:53294710-53294732 AAGGAGAAGCAATAGACCCAAGG + Intronic
1192978195 X:76308749-76308771 AGGGAGAATCACTTGACCCTGGG + Intergenic
1195331383 X:103804987-103805009 AGGCAGAAGCAATATACAAGAGG - Intergenic
1197760423 X:130024235-130024257 AGGGGGAAGCGCTTGCCCAGCGG + Intronic
1198261840 X:134972023-134972045 TGGGAGAGGCAATTCACCATGGG + Intergenic
1199653274 X:149969568-149969590 AGGAAGAAGCATCTGAGCAGAGG - Intergenic
1201273500 Y:12278128-12278150 AAGGAGAATCAATTGAACACGGG + Intergenic