ID: 994740551

View in Genome Browser
Species Human (GRCh38)
Location 5:103612323-103612345
Sequence GAGTGAAAAAGGATGGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994740551_994740554 -6 Left 994740551 5:103612323-103612345 CCATAGTCCATCCTTTTTCACTC No data
Right 994740554 5:103612340-103612362 TCACTCTGCCATACTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994740551 Original CRISPR GAGTGAAAAAGGATGGACTA TGG (reversed) Intergenic
No off target data available for this crispr