ID: 994740763

View in Genome Browser
Species Human (GRCh38)
Location 5:103615634-103615656
Sequence CTGCTGCAATAGTTCACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994740761_994740763 9 Left 994740761 5:103615602-103615624 CCTTAAAGAGATACCTGGGTAAA No data
Right 994740763 5:103615634-103615656 CTGCTGCAATAGTTCACCACAGG No data
994740762_994740763 -4 Left 994740762 5:103615615-103615637 CCTGGGTAAATATGATGAGCTGC No data
Right 994740763 5:103615634-103615656 CTGCTGCAATAGTTCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994740763 Original CRISPR CTGCTGCAATAGTTCACCAC AGG Intergenic
No off target data available for this crispr