ID: 994743378

View in Genome Browser
Species Human (GRCh38)
Location 5:103648509-103648531
Sequence TAGAGAAATGGGGGCATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994743372_994743378 -6 Left 994743372 5:103648492-103648514 CCAGTAATGATCCTGGTTAGAGA No data
Right 994743378 5:103648509-103648531 TAGAGAAATGGGGGCATCCCAGG No data
994743370_994743378 1 Left 994743370 5:103648485-103648507 CCATTTACCAGTAATGATCCTGG No data
Right 994743378 5:103648509-103648531 TAGAGAAATGGGGGCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994743378 Original CRISPR TAGAGAAATGGGGGCATCCC AGG Intergenic
No off target data available for this crispr