ID: 994746246

View in Genome Browser
Species Human (GRCh38)
Location 5:103681946-103681968
Sequence TTAGGCCATCTGCCCAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994746246_994746248 -6 Left 994746246 5:103681946-103681968 CCCAAGTTGGGCAGATGGCCTAA No data
Right 994746248 5:103681963-103681985 GCCTAAATCACCTCTTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994746246 Original CRISPR TTAGGCCATCTGCCCAACTT GGG (reversed) Intergenic
No off target data available for this crispr