ID: 994750348

View in Genome Browser
Species Human (GRCh38)
Location 5:103729752-103729774
Sequence ATGTAGTTCTTCAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994750348_994750350 -10 Left 994750348 5:103729752-103729774 CCTGCTTCCTTGAAGAACTACAT No data
Right 994750350 5:103729765-103729787 AGAACTACATTCAATTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994750348 Original CRISPR ATGTAGTTCTTCAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr