ID: 994751121

View in Genome Browser
Species Human (GRCh38)
Location 5:103738143-103738165
Sequence CTTCTCATGCAGAATGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994751120_994751121 19 Left 994751120 5:103738101-103738123 CCATTGCTTCTTGACTTTCAGGC No data
Right 994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994751121 Original CRISPR CTTCTCATGCAGAATGTGAT TGG Intergenic
No off target data available for this crispr