ID: 994758626

View in Genome Browser
Species Human (GRCh38)
Location 5:103826259-103826281
Sequence AACTAGTTCTATGGGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994758626_994758631 -10 Left 994758626 5:103826259-103826281 CCTTCCTACCCATAGAACTAGTT No data
Right 994758631 5:103826272-103826294 AGAACTAGTTTGAGAGGCTGAGG No data
994758626_994758632 9 Left 994758626 5:103826259-103826281 CCTTCCTACCCATAGAACTAGTT No data
Right 994758632 5:103826291-103826313 GAGGCATATTGCTCCAGTGAAGG No data
994758626_994758633 10 Left 994758626 5:103826259-103826281 CCTTCCTACCCATAGAACTAGTT No data
Right 994758633 5:103826292-103826314 AGGCATATTGCTCCAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994758626 Original CRISPR AACTAGTTCTATGGGTAGGA AGG (reversed) Intergenic
No off target data available for this crispr