ID: 994760390

View in Genome Browser
Species Human (GRCh38)
Location 5:103844498-103844520
Sequence CAGTGTGAGGGGTGGCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994760376_994760390 27 Left 994760376 5:103844448-103844470 CCAGATGCCTTAAAAGTGACCCA No data
Right 994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG No data
994760380_994760390 8 Left 994760380 5:103844467-103844489 CCCAGCCCCTTCTGGTAGGCTTC No data
Right 994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG No data
994760377_994760390 20 Left 994760377 5:103844455-103844477 CCTTAAAAGTGACCCAGCCCCTT No data
Right 994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG No data
994760383_994760390 2 Left 994760383 5:103844473-103844495 CCCTTCTGGTAGGCTTCTGTTCA No data
Right 994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG No data
994760381_994760390 7 Left 994760381 5:103844468-103844490 CCAGCCCCTTCTGGTAGGCTTCT No data
Right 994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG No data
994760384_994760390 1 Left 994760384 5:103844474-103844496 CCTTCTGGTAGGCTTCTGTTCAT No data
Right 994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG No data
994760382_994760390 3 Left 994760382 5:103844472-103844494 CCCCTTCTGGTAGGCTTCTGTTC No data
Right 994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994760390 Original CRISPR CAGTGTGAGGGGTGGCTATA AGG Intergenic
No off target data available for this crispr