ID: 994770334

View in Genome Browser
Species Human (GRCh38)
Location 5:103973567-103973589
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994770331_994770334 6 Left 994770331 5:103973538-103973560 CCTGAAGGGGCTTGGTATTGTGT No data
Right 994770334 5:103973567-103973589 CCTCAGTGAAGGAGTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr