ID: 994789020

View in Genome Browser
Species Human (GRCh38)
Location 5:104200441-104200463
Sequence TGTTTTTTGTTGCTGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994789020_994789026 -7 Left 994789020 5:104200441-104200463 CCCACCACCAGCAACAAAAAACA No data
Right 994789026 5:104200457-104200479 AAAAACAAAGAGGTGGTGTTAGG No data
994789020_994789027 -3 Left 994789020 5:104200441-104200463 CCCACCACCAGCAACAAAAAACA No data
Right 994789027 5:104200461-104200483 ACAAAGAGGTGGTGTTAGGAAGG No data
994789020_994789028 21 Left 994789020 5:104200441-104200463 CCCACCACCAGCAACAAAAAACA No data
Right 994789028 5:104200485-104200507 GAGAAAACACATCGATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994789020 Original CRISPR TGTTTTTTGTTGCTGGTGGT GGG (reversed) Intergenic