ID: 994789021

View in Genome Browser
Species Human (GRCh38)
Location 5:104200442-104200464
Sequence TTGTTTTTTGTTGCTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994789021_994789027 -4 Left 994789021 5:104200442-104200464 CCACCACCAGCAACAAAAAACAA No data
Right 994789027 5:104200461-104200483 ACAAAGAGGTGGTGTTAGGAAGG No data
994789021_994789026 -8 Left 994789021 5:104200442-104200464 CCACCACCAGCAACAAAAAACAA No data
Right 994789026 5:104200457-104200479 AAAAACAAAGAGGTGGTGTTAGG No data
994789021_994789028 20 Left 994789021 5:104200442-104200464 CCACCACCAGCAACAAAAAACAA No data
Right 994789028 5:104200485-104200507 GAGAAAACACATCGATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994789021 Original CRISPR TTGTTTTTTGTTGCTGGTGG TGG (reversed) Intergenic