ID: 994789022

View in Genome Browser
Species Human (GRCh38)
Location 5:104200445-104200467
Sequence TCTTTGTTTTTTGTTGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994789022_994789027 -7 Left 994789022 5:104200445-104200467 CCACCAGCAACAAAAAACAAAGA No data
Right 994789027 5:104200461-104200483 ACAAAGAGGTGGTGTTAGGAAGG No data
994789022_994789028 17 Left 994789022 5:104200445-104200467 CCACCAGCAACAAAAAACAAAGA No data
Right 994789028 5:104200485-104200507 GAGAAAACACATCGATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994789022 Original CRISPR TCTTTGTTTTTTGTTGCTGG TGG (reversed) Intergenic