ID: 994789027

View in Genome Browser
Species Human (GRCh38)
Location 5:104200461-104200483
Sequence ACAAAGAGGTGGTGTTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994789022_994789027 -7 Left 994789022 5:104200445-104200467 CCACCAGCAACAAAAAACAAAGA No data
Right 994789027 5:104200461-104200483 ACAAAGAGGTGGTGTTAGGAAGG No data
994789020_994789027 -3 Left 994789020 5:104200441-104200463 CCCACCACCAGCAACAAAAAACA No data
Right 994789027 5:104200461-104200483 ACAAAGAGGTGGTGTTAGGAAGG No data
994789021_994789027 -4 Left 994789021 5:104200442-104200464 CCACCACCAGCAACAAAAAACAA No data
Right 994789027 5:104200461-104200483 ACAAAGAGGTGGTGTTAGGAAGG No data
994789024_994789027 -10 Left 994789024 5:104200448-104200470 CCAGCAACAAAAAACAAAGAGGT No data
Right 994789027 5:104200461-104200483 ACAAAGAGGTGGTGTTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994789027 Original CRISPR ACAAAGAGGTGGTGTTAGGA AGG Intergenic