ID: 994791522

View in Genome Browser
Species Human (GRCh38)
Location 5:104232631-104232653
Sequence AGGTGCTGCAGTGGAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994791514_994791522 23 Left 994791514 5:104232585-104232607 CCAATCAATGACACAATGAGTAT No data
Right 994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG No data
994791519_994791522 -2 Left 994791519 5:104232610-104232632 CCAGGGAGGAAGGCTTTAATAAG No data
Right 994791522 5:104232631-104232653 AGGTGCTGCAGTGGAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994791522 Original CRISPR AGGTGCTGCAGTGGAAGAGA TGG Intergenic
No off target data available for this crispr