ID: 994796169

View in Genome Browser
Species Human (GRCh38)
Location 5:104302508-104302530
Sequence CTGTGTGAACAGAGGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994796169_994796173 7 Left 994796169 5:104302508-104302530 CCATGCTTCCTCTGTTCACACAG No data
Right 994796173 5:104302538-104302560 CTTCCTCTCGCCACTCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994796169 Original CRISPR CTGTGTGAACAGAGGAAGCA TGG (reversed) Intergenic
No off target data available for this crispr