ID: 994798480

View in Genome Browser
Species Human (GRCh38)
Location 5:104338318-104338340
Sequence ATTTTTCAGGGGATTGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994798480_994798484 6 Left 994798480 5:104338318-104338340 CCTAACACAATCCCCTGAAAAAT No data
Right 994798484 5:104338347-104338369 GTTGTGACTAGAAATTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994798480 Original CRISPR ATTTTTCAGGGGATTGTGTT AGG (reversed) Intergenic
No off target data available for this crispr