ID: 994805292

View in Genome Browser
Species Human (GRCh38)
Location 5:104439379-104439401
Sequence ATTAAGAAAACCAATAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994805290_994805292 -4 Left 994805290 5:104439360-104439382 CCAGATAAAAGAAAATGTTATTA 0: 2
1: 22
2: 49
3: 106
4: 667
Right 994805292 5:104439379-104439401 ATTAAGAAAACCAATAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994805292 Original CRISPR ATTAAGAAAACCAATAAGGA AGG Intergenic
No off target data available for this crispr