ID: 994808222

View in Genome Browser
Species Human (GRCh38)
Location 5:104479216-104479238
Sequence GTCTCAAGGCTGTACAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994808222_994808229 25 Left 994808222 5:104479216-104479238 CCTGCTCTGTACAGCCTTGAGAC No data
Right 994808229 5:104479264-104479286 CAGCTCCAGTCAGCGTTAAAAGG No data
994808222_994808230 26 Left 994808222 5:104479216-104479238 CCTGCTCTGTACAGCCTTGAGAC No data
Right 994808230 5:104479265-104479287 AGCTCCAGTCAGCGTTAAAAGGG No data
994808222_994808231 27 Left 994808222 5:104479216-104479238 CCTGCTCTGTACAGCCTTGAGAC No data
Right 994808231 5:104479266-104479288 GCTCCAGTCAGCGTTAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994808222 Original CRISPR GTCTCAAGGCTGTACAGAGC AGG (reversed) Intergenic
No off target data available for this crispr