ID: 994811573

View in Genome Browser
Species Human (GRCh38)
Location 5:104525615-104525637
Sequence ATTAATTATCTGGCCAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994811573_994811576 0 Left 994811573 5:104525615-104525637 CCTTTTTTGGCCAGATAATTAAT No data
Right 994811576 5:104525638-104525660 TTGGTATAAAACAAACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994811573 Original CRISPR ATTAATTATCTGGCCAAAAA AGG (reversed) Intergenic
No off target data available for this crispr