ID: 994816394

View in Genome Browser
Species Human (GRCh38)
Location 5:104592678-104592700
Sequence GGTCCCCAAAGACCACAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994816394_994816405 22 Left 994816394 5:104592678-104592700 CCAACTTGTGGTCTTTGGGGACC No data
Right 994816405 5:104592723-104592745 CAGGGACACCTTCCGCATTTGGG No data
994816394_994816398 3 Left 994816394 5:104592678-104592700 CCAACTTGTGGTCTTTGGGGACC No data
Right 994816398 5:104592704-104592726 GAAGATAGACTGCCCCCAACAGG No data
994816394_994816399 4 Left 994816394 5:104592678-104592700 CCAACTTGTGGTCTTTGGGGACC No data
Right 994816399 5:104592705-104592727 AAGATAGACTGCCCCCAACAGGG No data
994816394_994816404 21 Left 994816394 5:104592678-104592700 CCAACTTGTGGTCTTTGGGGACC No data
Right 994816404 5:104592722-104592744 ACAGGGACACCTTCCGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994816394 Original CRISPR GGTCCCCAAAGACCACAAGT TGG (reversed) Intergenic
No off target data available for this crispr