ID: 994825281

View in Genome Browser
Species Human (GRCh38)
Location 5:104705901-104705923
Sequence GTGGTGTGAAAGATGTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994825281_994825286 22 Left 994825281 5:104705901-104705923 CCAAGTGACATCTTTCACACCAC No data
Right 994825286 5:104705946-104705968 GATCCCCTTTTTATCTGTAATGG No data
994825281_994825282 -7 Left 994825281 5:104705901-104705923 CCAAGTGACATCTTTCACACCAC No data
Right 994825282 5:104705917-104705939 ACACCACTAATTCATTGCTATGG No data
994825281_994825288 25 Left 994825281 5:104705901-104705923 CCAAGTGACATCTTTCACACCAC No data
Right 994825288 5:104705949-104705971 CCCCTTTTTATCTGTAATGGAGG No data
994825281_994825283 -6 Left 994825281 5:104705901-104705923 CCAAGTGACATCTTTCACACCAC No data
Right 994825283 5:104705918-104705940 CACCACTAATTCATTGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994825281 Original CRISPR GTGGTGTGAAAGATGTCACT TGG (reversed) Intergenic
No off target data available for this crispr