ID: 994827807

View in Genome Browser
Species Human (GRCh38)
Location 5:104738124-104738146
Sequence ATGCTATTTTTGAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994827804_994827807 -8 Left 994827804 5:104738109-104738131 CCTCTTGGGATTTTGATGCTATT No data
Right 994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994827807 Original CRISPR ATGCTATTTTTGAGGGAAAA TGG Intergenic
No off target data available for this crispr