ID: 994847561

View in Genome Browser
Species Human (GRCh38)
Location 5:105009338-105009360
Sequence AGGATAGCAATACTATTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994847557_994847561 9 Left 994847557 5:105009306-105009328 CCCAAGGTTCTTCATTTCTAACA No data
Right 994847561 5:105009338-105009360 AGGATAGCAATACTATTGCTTGG No data
994847558_994847561 8 Left 994847558 5:105009307-105009329 CCAAGGTTCTTCATTTCTAACAA No data
Right 994847561 5:105009338-105009360 AGGATAGCAATACTATTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994847561 Original CRISPR AGGATAGCAATACTATTGCT TGG Intergenic
No off target data available for this crispr