ID: 994847673

View in Genome Browser
Species Human (GRCh38)
Location 5:105010913-105010935
Sequence GTCCTGTGAGAGGACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994847669_994847673 23 Left 994847669 5:105010867-105010889 CCAGCAGGTCACAGGGACTTAAA No data
Right 994847673 5:105010913-105010935 GTCCTGTGAGAGGACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994847673 Original CRISPR GTCCTGTGAGAGGACAGTGA GGG Intergenic
No off target data available for this crispr