ID: 994849569

View in Genome Browser
Species Human (GRCh38)
Location 5:105036671-105036693
Sequence CAAAACCCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994849569_994849572 4 Left 994849569 5:105036671-105036693 CCCATATCACTATCAGGGTTTTG No data
Right 994849572 5:105036698-105036720 AATCCATTCAATAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994849569 Original CRISPR CAAAACCCTGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr