ID: 994849572

View in Genome Browser
Species Human (GRCh38)
Location 5:105036698-105036720
Sequence AATCCATTCAATAAGTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994849570_994849572 3 Left 994849570 5:105036672-105036694 CCATATCACTATCAGGGTTTTGG No data
Right 994849572 5:105036698-105036720 AATCCATTCAATAAGTCTCTAGG No data
994849565_994849572 27 Left 994849565 5:105036648-105036670 CCACCTCAGCTTGAATCTTATTG No data
Right 994849572 5:105036698-105036720 AATCCATTCAATAAGTCTCTAGG No data
994849566_994849572 24 Left 994849566 5:105036651-105036673 CCTCAGCTTGAATCTTATTGCCC No data
Right 994849572 5:105036698-105036720 AATCCATTCAATAAGTCTCTAGG No data
994849569_994849572 4 Left 994849569 5:105036671-105036693 CCCATATCACTATCAGGGTTTTG No data
Right 994849572 5:105036698-105036720 AATCCATTCAATAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994849572 Original CRISPR AATCCATTCAATAAGTCTCT AGG Intergenic
No off target data available for this crispr