ID: 994855434

View in Genome Browser
Species Human (GRCh38)
Location 5:105113575-105113597
Sequence GACAGCTCTTGGCATGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994855434_994855437 11 Left 994855434 5:105113575-105113597 CCAGTAACATGCCAAGAGCTGTC No data
Right 994855437 5:105113609-105113631 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
994855434_994855439 16 Left 994855434 5:105113575-105113597 CCAGTAACATGCCAAGAGCTGTC No data
Right 994855439 5:105113614-105113636 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
994855434_994855438 15 Left 994855434 5:105113575-105113597 CCAGTAACATGCCAAGAGCTGTC No data
Right 994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994855434 Original CRISPR GACAGCTCTTGGCATGTTAC TGG (reversed) Intergenic
No off target data available for this crispr