ID: 994860334

View in Genome Browser
Species Human (GRCh38)
Location 5:105184765-105184787
Sequence CCCTATGTAAAGATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994860334_994860340 8 Left 994860334 5:105184765-105184787 CCCAGCACCATCTTTACATAGGG No data
Right 994860340 5:105184796-105184818 CCCCATTTCTTGTTTTTGTCAGG 0: 3531
1: 6139
2: 8967
3: 2824
4: 1125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994860334 Original CRISPR CCCTATGTAAAGATGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr