ID: 994868415

View in Genome Browser
Species Human (GRCh38)
Location 5:105310631-105310653
Sequence GTGTTCTAGTAGAAGTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994868415_994868417 16 Left 994868415 5:105310631-105310653 CCTGCTAACTTCTACTAGAACAC No data
Right 994868417 5:105310670-105310692 CTAGAACAACACTGTCAGTATGG No data
994868415_994868418 27 Left 994868415 5:105310631-105310653 CCTGCTAACTTCTACTAGAACAC No data
Right 994868418 5:105310681-105310703 CTGTCAGTATGGTAGTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994868415 Original CRISPR GTGTTCTAGTAGAAGTTAGC AGG (reversed) Intergenic
No off target data available for this crispr