ID: 994870700

View in Genome Browser
Species Human (GRCh38)
Location 5:105346971-105346993
Sequence TGGTCCAAATATAGATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994870700_994870704 24 Left 994870700 5:105346971-105346993 CCTGAAGATCTATATTTGGACCA No data
Right 994870704 5:105347018-105347040 CAGGTGACCATCATCTCTTGTGG No data
994870700_994870705 28 Left 994870700 5:105346971-105346993 CCTGAAGATCTATATTTGGACCA No data
Right 994870705 5:105347022-105347044 TGACCATCATCTCTTGTGGCTGG No data
994870700_994870703 5 Left 994870700 5:105346971-105346993 CCTGAAGATCTATATTTGGACCA No data
Right 994870703 5:105346999-105347021 TAAGTCATCAATTCAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994870700 Original CRISPR TGGTCCAAATATAGATCTTC AGG (reversed) Intergenic
No off target data available for this crispr