ID: 994875336

View in Genome Browser
Species Human (GRCh38)
Location 5:105414104-105414126
Sequence TCTAGGGCCCCTCCCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994875328_994875336 17 Left 994875328 5:105414064-105414086 CCCTGGTAGCTGAAGACAAAAGG No data
Right 994875336 5:105414104-105414126 TCTAGGGCCCCTCCCATTGCTGG No data
994875325_994875336 26 Left 994875325 5:105414055-105414077 CCCTATCCACCCTGGTAGCTGAA 0: 22
1: 96
2: 160
3: 230
4: 669
Right 994875336 5:105414104-105414126 TCTAGGGCCCCTCCCATTGCTGG No data
994875327_994875336 20 Left 994875327 5:105414061-105414083 CCACCCTGGTAGCTGAAGACAAA 0: 113
1: 206
2: 282
3: 256
4: 381
Right 994875336 5:105414104-105414126 TCTAGGGCCCCTCCCATTGCTGG No data
994875330_994875336 16 Left 994875330 5:105414065-105414087 CCTGGTAGCTGAAGACAAAAGGC No data
Right 994875336 5:105414104-105414126 TCTAGGGCCCCTCCCATTGCTGG No data
994875324_994875336 30 Left 994875324 5:105414051-105414073 CCTTCCCTATCCACCCTGGTAGC 0: 34
1: 125
2: 215
3: 167
4: 389
Right 994875336 5:105414104-105414126 TCTAGGGCCCCTCCCATTGCTGG No data
994875326_994875336 25 Left 994875326 5:105414056-105414078 CCTATCCACCCTGGTAGCTGAAG 0: 18
1: 86
2: 167
3: 202
4: 441
Right 994875336 5:105414104-105414126 TCTAGGGCCCCTCCCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994875336 Original CRISPR TCTAGGGCCCCTCCCATTGC TGG Intergenic
No off target data available for this crispr