ID: 994875344

View in Genome Browser
Species Human (GRCh38)
Location 5:105414138-105414160
Sequence CTACCACAGCTGATGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994875338_994875344 3 Left 994875338 5:105414112-105414134 CCCTCCCATTGCTGGTTCCTTCC No data
Right 994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG No data
994875339_994875344 2 Left 994875339 5:105414113-105414135 CCTCCCATTGCTGGTTCCTTCCA No data
Right 994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG No data
994875341_994875344 -2 Left 994875341 5:105414117-105414139 CCATTGCTGGTTCCTTCCATACT No data
Right 994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG No data
994875337_994875344 4 Left 994875337 5:105414111-105414133 CCCCTCCCATTGCTGGTTCCTTC No data
Right 994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG No data
994875340_994875344 -1 Left 994875340 5:105414116-105414138 CCCATTGCTGGTTCCTTCCATAC No data
Right 994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG No data
994875335_994875344 20 Left 994875335 5:105414095-105414117 CCTGGGTATTCTAGGGCCCCTCC No data
Right 994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994875344 Original CRISPR CTACCACAGCTGATGTTCTC TGG Intergenic
No off target data available for this crispr