ID: 994880901

View in Genome Browser
Species Human (GRCh38)
Location 5:105494166-105494188
Sequence AATATCAAATAGAGTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994880901_994880904 23 Left 994880901 5:105494166-105494188 CCTTCTTAACTCTATTTGATATT No data
Right 994880904 5:105494212-105494234 TACTGTCTTTTTTTTTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994880901 Original CRISPR AATATCAAATAGAGTTAAGA AGG (reversed) Intergenic
No off target data available for this crispr