ID: 994890145

View in Genome Browser
Species Human (GRCh38)
Location 5:105623071-105623093
Sequence GCACTCAGGAGAATTACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994890145_994890151 2 Left 994890145 5:105623071-105623093 CCTCAGGTAATTCTCCTGAGTGC No data
Right 994890151 5:105623096-105623118 CAGAGTAATCCCAGGGTGCTGGG No data
994890145_994890147 -6 Left 994890145 5:105623071-105623093 CCTCAGGTAATTCTCCTGAGTGC No data
Right 994890147 5:105623088-105623110 GAGTGCTCCAGAGTAATCCCAGG No data
994890145_994890148 -5 Left 994890145 5:105623071-105623093 CCTCAGGTAATTCTCCTGAGTGC No data
Right 994890148 5:105623089-105623111 AGTGCTCCAGAGTAATCCCAGGG No data
994890145_994890152 10 Left 994890145 5:105623071-105623093 CCTCAGGTAATTCTCCTGAGTGC No data
Right 994890152 5:105623104-105623126 TCCCAGGGTGCTGGGATTACAGG 0: 146
1: 11184
2: 305297
3: 318646
4: 297443
994890145_994890150 1 Left 994890145 5:105623071-105623093 CCTCAGGTAATTCTCCTGAGTGC No data
Right 994890150 5:105623095-105623117 CCAGAGTAATCCCAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994890145 Original CRISPR GCACTCAGGAGAATTACCTG AGG (reversed) Intergenic
No off target data available for this crispr