ID: 994895130

View in Genome Browser
Species Human (GRCh38)
Location 5:105693363-105693385
Sequence TCATGGCCATAAAACTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994895130_994895134 5 Left 994895130 5:105693363-105693385 CCAGGGAAGTTTTATGGCCATGA No data
Right 994895134 5:105693391-105693413 ATGGGAAGTGAGTGCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994895130 Original CRISPR TCATGGCCATAAAACTTCCC TGG (reversed) Intergenic
No off target data available for this crispr