ID: 994895134

View in Genome Browser
Species Human (GRCh38)
Location 5:105693391-105693413
Sequence ATGGGAAGTGAGTGCTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994895127_994895134 12 Left 994895127 5:105693356-105693378 CCATCTCCCAGGGAAGTTTTATG No data
Right 994895134 5:105693391-105693413 ATGGGAAGTGAGTGCTGAGATGG No data
994895126_994895134 13 Left 994895126 5:105693355-105693377 CCCATCTCCCAGGGAAGTTTTAT No data
Right 994895134 5:105693391-105693413 ATGGGAAGTGAGTGCTGAGATGG No data
994895129_994895134 6 Left 994895129 5:105693362-105693384 CCCAGGGAAGTTTTATGGCCATG No data
Right 994895134 5:105693391-105693413 ATGGGAAGTGAGTGCTGAGATGG No data
994895125_994895134 21 Left 994895125 5:105693347-105693369 CCATAAATCCCATCTCCCAGGGA No data
Right 994895134 5:105693391-105693413 ATGGGAAGTGAGTGCTGAGATGG No data
994895130_994895134 5 Left 994895130 5:105693363-105693385 CCAGGGAAGTTTTATGGCCATGA No data
Right 994895134 5:105693391-105693413 ATGGGAAGTGAGTGCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994895134 Original CRISPR ATGGGAAGTGAGTGCTGAGA TGG Intergenic
No off target data available for this crispr