ID: 994901168

View in Genome Browser
Species Human (GRCh38)
Location 5:105771471-105771493
Sequence GGGAGCAAGGGACCACAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994901168_994901180 22 Left 994901168 5:105771471-105771493 CCTACTTGTGGTCCCTTGCTCCC No data
Right 994901180 5:105771516-105771538 TGTCATACTATTAGTTCTTAGGG No data
994901168_994901179 21 Left 994901168 5:105771471-105771493 CCTACTTGTGGTCCCTTGCTCCC No data
Right 994901179 5:105771515-105771537 CTGTCATACTATTAGTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994901168 Original CRISPR GGGAGCAAGGGACCACAAGT AGG (reversed) Intergenic
No off target data available for this crispr