ID: 994906767

View in Genome Browser
Species Human (GRCh38)
Location 5:105849902-105849924
Sequence CTGAGAAGGACTCATCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994906767_994906774 25 Left 994906767 5:105849902-105849924 CCAGAATGATGAGTCCTTCTCAG No data
Right 994906774 5:105849950-105849972 AATGAATCACTCACTATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994906767 Original CRISPR CTGAGAAGGACTCATCATTC TGG (reversed) Intergenic
No off target data available for this crispr