ID: 994911658

View in Genome Browser
Species Human (GRCh38)
Location 5:105917234-105917256
Sequence GACCTTCACCTGCAACTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994911657_994911658 -7 Left 994911657 5:105917218-105917240 CCAAAAATAGGTAGAAGACCTTC No data
Right 994911658 5:105917234-105917256 GACCTTCACCTGCAACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994911658 Original CRISPR GACCTTCACCTGCAACTCCC TGG Intergenic
No off target data available for this crispr