ID: 994915641

View in Genome Browser
Species Human (GRCh38)
Location 5:105974397-105974419
Sequence GTTACTTCCATCCTAACGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994915641_994915645 7 Left 994915641 5:105974397-105974419 CCTGGCGTTAGGATGGAAGTAAC No data
Right 994915645 5:105974427-105974449 TATGCTGAGTTTATCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994915641 Original CRISPR GTTACTTCCATCCTAACGCC AGG (reversed) Intergenic
No off target data available for this crispr