ID: 994922857

View in Genome Browser
Species Human (GRCh38)
Location 5:106072932-106072954
Sequence TCAGTTGACCAGTTAATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994922855_994922857 -5 Left 994922855 5:106072914-106072936 CCTTAAAAAATGGTCCTGTCAGT No data
Right 994922857 5:106072932-106072954 TCAGTTGACCAGTTAATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994922857 Original CRISPR TCAGTTGACCAGTTAATGCA AGG Intergenic
No off target data available for this crispr