ID: 994927704

View in Genome Browser
Species Human (GRCh38)
Location 5:106139740-106139762
Sequence TGGGCTGTTTCTAGTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994927704_994927709 20 Left 994927704 5:106139740-106139762 CCAGGAAAACTAGAAACAGCCCA No data
Right 994927709 5:106139783-106139805 CTAGCAAGTATTCTGTAGCATGG No data
994927704_994927710 26 Left 994927704 5:106139740-106139762 CCAGGAAAACTAGAAACAGCCCA No data
Right 994927710 5:106139789-106139811 AGTATTCTGTAGCATGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994927704 Original CRISPR TGGGCTGTTTCTAGTTTTCC TGG (reversed) Intergenic
No off target data available for this crispr