ID: 994932369

View in Genome Browser
Species Human (GRCh38)
Location 5:106206027-106206049
Sequence GGCCCCAGTGCAGGATCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994932369_994932375 -2 Left 994932369 5:106206027-106206049 CCAGTGGATCCTGCACTGGGGCC No data
Right 994932375 5:106206048-106206070 CCCAAGGTGGAGGTGCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994932369 Original CRISPR GGCCCCAGTGCAGGATCCAC TGG (reversed) Intergenic
No off target data available for this crispr