ID: 994932402

View in Genome Browser
Species Human (GRCh38)
Location 5:106206152-106206174
Sequence GGGGAGGCTCCGGCCTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994932386_994932402 30 Left 994932386 5:106206099-106206121 CCCTTGGGCAGTTGATGGGACTG No data
Right 994932402 5:106206152-106206174 GGGGAGGCTCCGGCCTGCGCAGG No data
994932396_994932402 3 Left 994932396 5:106206126-106206148 CCGTGGAGCAGGGGGCGGCACTC 0: 40
1: 299
2: 464
3: 467
4: 420
Right 994932402 5:106206152-106206174 GGGGAGGCTCCGGCCTGCGCAGG No data
994932387_994932402 29 Left 994932387 5:106206100-106206122 CCTTGGGCAGTTGATGGGACTGG No data
Right 994932402 5:106206152-106206174 GGGGAGGCTCCGGCCTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994932402 Original CRISPR GGGGAGGCTCCGGCCTGCGC AGG Intergenic
No off target data available for this crispr